sigI [2020-04-21 14:55:09]

RNA polymerase sigma factor SigI

Locus: BSU_13450

Isoelectric point: 8.31

Molecular weight: 29.04 kDa

Protein length: 251 aa

Gene length: 756 bp

Function: control of a class of heat shock genes

Product: RNA polymerase sigma factor SigI

Essential: no

Synonyms: ykoZ

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → RNA synthesis and degradation → Transcription → Sigma factors
• Information processing → Regulation of gene expression → Sigma factors and their control → Sigma factors
• Lifestyles → Coping with stress → Heat shock proteins

Gene

Coordinates: 1,411,892 1,412,647

Phenotypes of a mutant

• temperature-sensitive growth on agar plates PubMed

The protein

Protein family

• Sigma-70 factor family (according to UniProt)

Localization

• information on binding sites can be found in the PRODORIC2 database

Additional information

• overexpression of SigI suppresses mreB mreBH mbl mutants PubMed

Expression and Regulation

Operons

• Genes: sigI-rsgI
  Description: PubMed

  Sigma factors

  • SigI: sigma factor, PubMed, in SigI regulon
  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • WalR: activation, PubMed, in WalR regulon

  Regulation

  • induced at high temperature (SigI, WalR) PubMed

Biological materials

Mutant

• MGNA-A229 (ykoZ::erm), available at the NBRP B. subtilis, Japan
• BKE13450 (sigI::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACCTCAGTTCCTCCCTATA, downstream forward: _UP4_TATCTTAAAGGGGTGCTGCA
• BKK13450 (sigI::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACCTCAGTTCCTCCCTATA, downstream forward: _UP4_TATCTTAAAGGGGTGCTGCA

References

Loading